TITLE

Evidence for the Presence of HABP1 Pseudogene in Multiple Locations of Mammalian Genome

AUTHOR(S)
Majumdar, M.; Bharadwaj, A.; Ghosh, Ilora; Ramachandran, S.; Datta, K.
PUB. DATE
October 2002
SOURCE
DNA & Cell Biology;Oct2002, Vol. 21 Issue 10, p727
SOURCE TYPE
Academic Journal
DOC. TYPE
Article
ABSTRACT
The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at ~5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5′ promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.
ACCESSION #
7738514

 

Related Articles

  • A Novel Hyaluronidase Produced by Bacillus sp. A50. Guo, Xueping; Shi, Yanli; Sheng, Juzheng; Wang, Fengshan // PLoS ONE;Apr2014, Vol. 9 Issue 4, p1 

    Hyaluronidases are a family of enzymes that degrade hyaluronic acid (hyaluronan, HA) and widely used in many fields. A hyaluronidase producing bacteria strain was screened from the air. 16S ribosomal DNA (16S rDNA) analysis indicated that the strain belonged to the genus Bacillus, and the strain...

  • Hyaluronan seeps into cancer treatment trials. Ziegler, Jan // JNCI: Journal of the National Cancer Institute;4/3/96, Vol. 88 Issue 7, p397 

    Focuses on the role played by hyaluronan molecules in cancer development and progression. Hyaluronan's involvement in cell transformation and cancer cell metastasis; Hyaluronan's anti-tumor characteristics; Background on research efforts to determine the chemical's therapeutic uses.

  • DEGRADATION OF HYALURONAN SAMPLES WITH THE ADDITION OF ASCORBIC ACID, CU (II), Fe (II) AND Mn (II) IONS. Valachova, Katarina; Soltes, Ladislav; Gemeiner, Peter; Bauerova, Katarina // Biomedical Papers of the Medical Faculty of Palacky University i;2007, Vol. 151, p97 

    An abstract of the medical research "DEGRADATION OF HYALURONAN SAMPLES WITH THE ADDITION OF ASCORBIC ACID, CU (II), Fe (II) AND Mn (II) IONS," by Katarina Valachova, Ladislav Soltes, Peter Gemeiner and Katarina Bauerova is presented.

  • Research & Markets: U.S. Hyaluronic Acid Viscosupplementation Physician Survey 2011.  // Biomedical Market Newsletter;9/12/2011, Vol. 21, p348 

    An abstract of the article "U.S. Hyaluronic Acid Viscosupplementation Physician Survey 2011" is presented.

  • Population Genetic Analysis of Propionibacterium acnes Identifies a Subpopulation and Epidemic Clones Associated with Acne. Lomholt, Hans B.; Kilian, Mogens // PLoS ONE;2010, Vol. 5 Issue 8, p1 

    The involvement of Propionibacterium acnes in the pathogenesis of acne is controversial, mainly owing to its dominance as an inhabitant of healthy skin. This study tested the hypothesis that specific evolutionary lineages of the species are associated with acne while others are compatible with...

  • Pleural Tissue Hyaluronan Produced by Postmortem Ventilation in Rabbits. Wang, P. M.; Lai-Fook, S. J. // Lung;2000, Vol. 178 Issue 1, p1 

    Abstract. We developed a method that used Alcian blue bound to hyaluronan to measure pleural hyaluronan in rabbits postmortem. Rabbits were killed, then ventilated with 21% O[sub 2]-5% CO[sub 2]-74% N[sub 2] for 3 h. The pleural liquid was removed by suction and 5 ml Alcian blue stock solution...

  • Restylane fills expectations. Schneider, Ellen Meyer // Cosmetic Surgery Times;Nov/Dec2002, Vol. 5 Issue 10, p1 

    Reports that the Restylane nonanimal stabilized hyaluronic acid filler lasts longer the collagen-based Zyplast when both are injected into the nasolabial folds of study subjects. Dermatological functions of the products.

  • Hyaluronic acid in bronchoalveolar lavage in rats exposed to quartz Eklund, A.; Engstrom-Laurent, A.; Hallgren, R.; Tornling, G.; Unge, G.; Westman, B. // British Journal of Industrial Medicine;Jul1987, Vol. 44 Issue 7, p443 

    No abstract available.

  • COMBATING Arthritis Pain. Black, Peggy // Alive: Canada's Natural Health & Wellness Magazine;Aug2002, Issue 238, p78 

    Examines the effects of administering a natural substance combination on treating arthritis in Canada. List of natural substances used; Synthesis of hyaluronic acid in the joints; Components of methyl sulfonyl methane solution.

Share

Read the Article

Courtesy of VIRGINIA BEACH PUBLIC LIBRARY AND SYSTEM

Sorry, but this item is not currently available from your library.

Try another library?
Sign out of this library

Other Topics