TITLE

On the tunnel electron transport in metal/Langmuir–Blodgett film/metal systems

AUTHOR(S)
Barraud, André; Millie, Philippe; Yakimenko, Irina
PUB. DATE
October 1996
SOURCE
Journal of Chemical Physics;10/22/1996, Vol. 105 Issue 16, p6972
SOURCE TYPE
Academic Journal
DOC. TYPE
Article
ABSTRACT
This paper presents a new method for the calculation of the tunnel current through a metal/multilayer of conjugated molecules/metal sandwich structure under low and moderate electric fields. The electron transfer from one electrode to the other through the cascaded molecules is treated step by step by considering hopping integrals between neighboring molecules. A rather simple computer calculation gives access to the tunnel current. A second approach is also given which consists in approximating the cascaded tunnel mechanism by a homogeneous rectangular insulating barrier, the height of which can be calculated simply from the basic parameters of the system. These two calculation methods have been applied to a practical system: Langmuir–Blodgett films made of a two-dimensional porphyrin polymer. The lowest unoccupied molecular orbital (LUMO) level in tetrapyridino–porphyrin bromide, which is the monomeric unit of the polymer, has been calculated and found at 2.8 eV below vacuum level. From this value and literature values for the other parameters, the tunnel current densities vs voltage have been calculated for various film thicknesses (2–5 monomolecular layers). The two calculation methods give quite close values for the tunnel current densities. The tetrapyridinoporphyrin polymeric Langmuir–Blodgett film is suggested to check the model experimentally, because once fabricated, the rigid polymeric film cannot undergo molecular reorganisation or evaporation and hence should contain few pinholes. © 1996 American Institute of Physics.
ACCESSION #
7640057

 

Related Articles

  • Voltage Dependency of Transmission Probability of Aperiodic DNA Molecule. Wiliyanti, V.; Yudiarsah, E. // AIP Conference Proceedings;2017, Vol. 1862 Issue 1, p1 

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA...

  • Field-dependent transport of electrons in selectively doped AlGaAs/GaAs/AlGaAs double-heterojunction systems. Inoue, Kaoru; Sakaki, Hiroyuki; Yoshino, Junji // Applied Physics Letters;9/15/1985, Vol. 47 Issue 6, p614 

    The transport properties of high-mobility electrons in selectively doped AlGaAs/GaAs/AlGaAs double-heterojunction systems have been investigated for electric fields (E) up to several kV/cm by pulsed Hall and pulsed current-voltage measurements. It was found that electron mobilities began to...

  • Formation of electron internal transport barrier and achievement of high ion temperature in Large Helical Device. Takeiri, Y.; Shimozuma, T.; Kubo, S.; Morita, S.; Osakabe, M.; Kaneko, O.; Tsumori, K.; Oka, Y.; Ikeda, K.; Nagaoka, K.; Ohyabu, N.; Ida, K.; Yokoyama, M.; Miyazawa, J.; Goto, M.; Narihara, K.; Yamada, I.; Idei, H.; Yoshimura, Y. // Physics of Plasmas;May2003, Vol. 10 Issue 5, p1788 

    An internal transport barrier (ITB) was observed in the electron temperature profile in the Large Helical Device [O. Motojima et al., Phys. Plasmas 6, 1843 (1999)] with a centrally focused intense electron cyclotron resonance microwave heating. Inside the ITB the core electron transport was...

  • Electron and hole transport in the organic small molecule α-NPD. Rohloff, R.; Kotadiya, N. B.; Crăciun, N. I.; Blom, P. W. M.; Wetzelaer, G. A. H. // Applied Physics Letters;2/13/2017, Vol. 110 Issue 7, p1 

    Electron and hole transport properties of the organic small molecule N,N'-Di(1-naphthyl)-N,N'-diphenyl-(1,1'-biphenyl)-4,4'-diamine are investigated by space-charge-limited current measurements. The hole transport shows trap-free behavior with a mobility of 2.3×10-8m2/Vs at vanishing carrier...

  • Grain boundary effects on carrier transport in undoped polycrystalline chemical-vapor-deposited.... Han, S.; Wagner, R.S. // Applied Physics Letters;5/20/1996, Vol. 68 Issue 21, p3016 

    Examines the grain-boundary effects on the carrier transport properties in polycrystalline chemical-vapor-deposited diamond. Use of hard X-ray excitation source; Variation of applied electric field intensity; Degradation in the carrier transport properties.

  • Hole-assisted Zener magnetotunneling in heterostructures. Cinelli, Riccardo A. G.; Piazza, Vincenzo; De Franceschi, Silvano; Lazzarino, Marco; Beltram, Fabio; Sivco, Deborah L.; Cho, Alfred Y. // Applied Physics Letters;12/14/1998, Vol. 73 Issue 24 

    Electron transport at high electric fields is investigated in a periodic semiconductor heterostructure. We present the analysis of the magnetic-field dependence of resonant Zener tunneling from a valence-band subband to a conduction-band subband in a multiple-quantum-well heterostructure. It is...

  • Time-of-flight measurement of electron velocity in an In0.52Al0.48As/In0.53Ga0.47As /In0.52Al0.48As double heterostructure. Shigekawa, Naoteru; Furuta, Tomofumi; Arai, Kunihiro // Applied Physics Letters;7/2/1990, Vol. 57 Issue 1, p67 

    The electron velocity versus electric field (v-E) relationship was measured between 0 and 12 kV/cm at room temperature for a selectively Be-doped In0.52Al0.48As/In0.53Ga0.47As /In0.52Al0.48As double heterostructure. It was found that the observed electron velocity is greater than that previously...

  • Molecules excited to regions of high state density are not deflected by an inhomogeneous electric field. Fraser, Gerald T.; Pate, Brooks H. // Journal of Chemical Physics;2/1/1993, Vol. 98 Issue 3, p2477 

    Conclusive experimental evidence is presented that molecules excited to a single ro-vibrational eigenstate in a high density-of-states region are not deflected by an inhomogeneous electric field. The onset of nondeflection behavior occurs in the same density of states region as has been found...

  • Induced infrared absorption of nitrogen physisorbed on NaCl films. Dai, David J. // Journal of Chemical Physics;2/8/1996, Vol. 104 Issue 6, p2461 

    The induced infrared absorption of N2 physisorbed on annealed NaCl films is observed. Analysis of spectroscopic and thermodynamic data is consistent with molecules adsorption on defect sites and on Na+ sites of smooth NaCl(100) faces of the film crystallites. Isotherms of N2 on the smooth face...

Share

Read the Article

Courtesy of THE LIBRARY OF VIRGINIA

Sorry, but this item is not currently available from your library.

Try another library?
Sign out of this library

Other Topics