TITLE

A paradigm shift in the delivery of services for diagnosis of inherited retinal disease

AUTHOR(S)
O'Sullivan, James; Mullaney, Brendan G.; Bhaskar, Sanjeev S.; Dickerson, Jonathan E.; Hall, Georgina; O'Grady, Anna; Webster, Andrew; Ramsden, Simon C.; Black, Graeme C.
PUB. DATE
May 2012
SOURCE
Journal of Medical Genetics;May2012, Vol. 49 Issue 5, p322
SOURCE TYPE
Academic Journal
DOC. TYPE
Article
ABSTRACT
Objectives Current technologies for delivering gene testing are labour-intensive and expensive. Over the last 3 years, new high-throughput DNA sequencing techniques (next generation sequencing; NGS), with the capability to analyse multiple genes or entire genomes, have been rapidly adopted into research. This study examines the possibility of incorporating NGS into a clinical UK service context. Methods The study applied NGS of 105 genes to 50 patients known to be affected by inherited forms of blindness in the setting of a UK National Health Serviceaccredited diagnostic molecular genetics laboratory. The study assessed the ability of an NGS protocol to identify likely disease-causing genetic variants when compared with current methodologies available through UK diagnostic laboratories. Results Conventional testing is only applicable to the minority of patients with inherited retinal disease and identifies mutations in fewer than one in four of those patients tested. By contrast, the NGS assay is directed at all patients with such disorders and identifies diseasecausing mutations in 50-55%, which is a dramatic increase. This includes patients with apparently 'sporadic' disease, and those for whom clinical management and prognosis are altered as a consequence of defining their disease at a molecular level. Conclusions The new NGS approach delivers a step change in the diagnosis of inherited eye disease, provides precise diagnostic information and extends the possibility of targeted treatments including gene therapy. The approach represents an exemplar that illustrates the opportunity that NGS provides for broadening the availability of genetic testing. The technology will be applied to many conditions that are associated with high levels of genetic heterogeneity.
ACCESSION #
75594712

 

Related Articles

  • Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause X-linked complete congenital stationary night blindness. Bech-Hansen, N.Torben; Naylor, Margaret J.; Maybaum, Tracy A.; Sparkes, Rebecca L.; Koop, Ben; Birch, David G.; Bergen, Arthur A.B.; Prinsen, Clemens F.M.; Polomeno, Robert C.; Gal, Andreas; Drack, Arlene V.; Musarella, Maria A.; Jacobson, Samuel G.; Young, Rockefeller S.L.; Weleber, Richard G. // Nature Genetics;Nov2000, Vol. 26 Issue 3, p319 

    During development, visual photoreceptors, bipolar cells and other neurons establish connections within the retina enabling the eye to process visual images over approximately 7 log units of illumination. Within the retina, cells that respond to light increment and light decrement are separated...

  • Characterization of four short tandem repeat loci (TH01, VWA31/A, CD4, and TP53) in Northern... Gusmao, Leonor; Prata, Maia Joao // Human Biology;Feb97, Vol. 69 Issue 1, p31 

    Presents data on the three loci (CD4, THO1, VWA3/A) and a segregation analysis on the TP3 system. Distinguishing loci in homozygotes and heterozygtotes by electrophoretic and heteroduplex analysis; Two dimensional representation of the analysis of 4 populations for 25 alleles at 3 loci.

  • Why DNA testing isn’t always good. Gillett, George // New Statesman;8/15/2014, Vol. 143 Issue 5223, p19 

    The article looks at the use of individual genetic information in medicine. The author cites a British National Health Service (NHS) project to sequence the DNA of a large number of patients and describes advantages genetic information may confer, including personalized treatment and disease...

  • Characterization of a Subcloned Fragment (pBA0.6) of pCMM86 Located on 17q21 and Its Potential Use in Generating an Individual-Specific DNA Profile. Saha, A.; Husain, S.; Bamezai, R. // DNA & Cell Biology;Apr2000, Vol. 19 Issue 4, p219 

    Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present...

  • Ownership of the human genome. Thomas, S.M.; Davies, A.R.W. // Nature;4/4/1996, Vol. 380 Issue 6573, p387 

    Comments on issues pertaining to the patenting of human DNA sequences. The Human Genome Project (HGP); The belief that patents are necessary for the successful commercial exploitation of the HGP for new therapeutic and diagnostic tools; Detailed results of a comprehensive analysis of patented...

  • A new strategy for genome sequencing. Venter, J. Craig; Smith, Hamilton O. // Nature;5/30/1996, Vol. 381 Issue 6581, p364 

    Opinion. Discusses an alternative strategy to sequence human genome in which any number of laboratories can cooperate. Implications for the Human Genome Project; Traditional approach used in sequencing genome; Benefits of the alternative approach; Principles behind the alternative strategy;...

  • 'Once More unto the Breach…' Branca, Malorye // Bio-IT World;Sep2003, Vol. 2 Issue 9, p22 

    Examines the approach used by Australian mathematicians group Combinomics to plug gaps in human genome sequencing. Reason why DNA sequence can prove unreadable by conventional methods; Goal of the group; Actions taken to test the approach.

  • Entering the era of molecular dentistry. Slavkin, Harold C. // Journal of the American Dental Association (JADA);Mar1999, Vol. 130 Issue 3, p413 

    Discusses how the supporting tissues and organs that compose the craniofacial-oral-dental complex will be better understood at the molecular level by deciphering the human genome. Use of computer-assisted information technology; Classification of mendelian traits; Single-gene diseases; Complex...

  • Retinal Diseases Caused by Mutations in Genes Not Specifically Associated with the Clinical Diagnosis. Wang, Xia; Feng, Yanming; Li, Jianli; Zhang, Wei; Wang, Jing; Lewis, Richard A.; Wong, Lee-Jun // PLoS ONE;10/27/2016, Vol. 11 Issue 10, p1 

    Purpose: When seeking a confirmed molecular diagnosis in the research setting, patients with one descriptive diagnosis of retinal disease could carry pathogenic variants in genes not specifically associated with that description. However, this event has not been evaluated systematically in...

Share

Read the Article

Courtesy of VIRGINIA BEACH PUBLIC LIBRARY AND SYSTEM

Sign out of this library

Other Topics