TITLE

Characterization of a Subcloned Fragment (pBA0.6) of pCMM86 Located on 17q21 and Its Potential Use in Generating an Individual-Specific DNA Profile

AUTHOR(S)
Saha, A.; Husain, S.; Bamezai, R.
PUB. DATE
April 2000
SOURCE
DNA & Cell Biology;Apr2000, Vol. 19 Issue 4, p219
SOURCE TYPE
Academic Journal
DOC. TYPE
Article
ABSTRACT
Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was GC-rich and minisatellitic in nature. Genomic blots of HaeIII-digested human DNA, when hybridized with pBA0.6, generated a ladder of bands between 29.0 kb and 2.1 kb. Hybridization analyses of 88 unrelated individuals belonging to four regions of India using this probe revealed polymorphic bands which were individual specific. The probability of identity ranged from 5.07 X 10[sup -14] in Punjabis to 2.64 X 10[sup -16] in Bengalis and was found to be 3.06 X 10[sup -16] in UPites, whereas in the case of South Indians, it was 3.9 X 10[sup -15]. Three sets of isomorphic bands at 29.0 kb, 2.4 kb, and 2.1 kb were common between the individuals of all the regions and served as internal markers. The 29.0-kb band was observed to be Homo sapiens specific. Construction of dendrograms based on the UPGMA method with Jaccard’s coefficient values suggested less genetic similarity/high genetic diversity in all the population groups, indicating that the samples taken were random. Maximum likelihood estimates through the bootstrap sampling method showed that Punjabis, Bengalis, and UPites formed one cluster, whereas South Indians formed a separate cluster, altogether thus showing the proximity of these three population groups compared with that from South India. A preliminary study by Northern hybridization with pBA0.6 resulted in two transcripts of 0.63 kb and 0.29 kb. This finding was corroborated with RT-PCR results where 2 amplicons, matching the expected size of two open reading frames within the minisatellite sequence, were obtained. The role of the two transcripts from the minisatellite sequence is not clear as yet, and it is probable that these messages may not get translated because of the absence of a eukaryotic Kozak sequence around the initiator methionine in the pBA0.6 sequence.
ACCESSION #
5322742

 

Related Articles

  • Characterization of four short tandem repeat loci (TH01, VWA31/A, CD4, and TP53) in Northern... Gusmao, Leonor; Prata, Maia Joao // Human Biology;Feb97, Vol. 69 Issue 1, p31 

    Presents data on the three loci (CD4, THO1, VWA3/A) and a segregation analysis on the TP3 system. Distinguishing loci in homozygotes and heterozygtotes by electrophoretic and heteroduplex analysis; Two dimensional representation of the analysis of 4 populations for 25 alleles at 3 loci.

  • Ownership of the human genome. Thomas, S.M.; Davies, A.R.W. // Nature;4/4/1996, Vol. 380 Issue 6573, p387 

    Comments on issues pertaining to the patenting of human DNA sequences. The Human Genome Project (HGP); The belief that patents are necessary for the successful commercial exploitation of the HGP for new therapeutic and diagnostic tools; Detailed results of a comprehensive analysis of patented...

  • A new strategy for genome sequencing. Venter, J. Craig; Smith, Hamilton O. // Nature;5/30/1996, Vol. 381 Issue 6581, p364 

    Opinion. Discusses an alternative strategy to sequence human genome in which any number of laboratories can cooperate. Implications for the Human Genome Project; Traditional approach used in sequencing genome; Benefits of the alternative approach; Principles behind the alternative strategy;...

  • 'Once More unto the Breach…' Branca, Malorye // Bio-IT World;Sep2003, Vol. 2 Issue 9, p22 

    Examines the approach used by Australian mathematicians group Combinomics to plug gaps in human genome sequencing. Reason why DNA sequence can prove unreadable by conventional methods; Goal of the group; Actions taken to test the approach.

  • Polyphasic taxonomy of the basidiomycetous yeast genus Rhodosporidium: R. azoricum sp. nov. Gadanho, M; Sampaio, J P; Spencer-Martins, I // Canadian Journal of Microbiology;Mar2001, Vol. 47 Issue 3, p213 

    This report presents the description of a new heterothallic Rhodosporidium species, R. azoricum sp. nov. The new species is based on two strains previously identified as Rhodotorula glutinis, which were isolated from soil in São Miguel island, Azores, Portugal. Evidence that the two strains...

  • Familial Identification: Population Structure and Relationship Distinguishability. Rohlfs, Rori V.; Fullerton, Stephanie Malia; Weir, Bruce S. // PLoS Genetics;Feb2012, Vol. 8 Issue 2, Special section p1 

    With the expansion of offender/arrestee DNA profile databases, genetic forensic identification has become commonplace in the United States criminal justice system. Implementation of familial searching has been proposed to extend forensic identification to family members of individuals with...

  • Muta-genetics or muta-genomics: the feasibility of large-scale mutagenesis and phenotyping programs. Nadeau, Joseph H. // Mammalian Genome;Jul2000, Vol. 11 Issue 7, p603 

    This article focuses on muta-genetics and phenotyping programs. As the first phase of the Human Genome Project approaches completion, attention shifts from questions of genome structure to problems of gene function. Gene maps and DNA sequences appear at an exponential rate in public databases...

  • Announcements.  // Mammalian Genome;Nov2000, Vol. 11 Issue 11, p1040 

    This article focuses on the NIH mouse genome sequencing network. As part of the NIH Mouse Genome Sequencing Network's effort to determine the complete DNA sequence of the laboratory mouse, strain CS7BL/6J, the National Human Genome Research Institute (NHGRI), has initiated a program that will...

  • Sequences flanking the centromere ofhuman chromosome 10 are a complex patchworkof arm-specific sequences, stable duplications and unstable sequences with homologies to telomeric and other centromeric locations. Jackson, M. S.; Rocchi, M.; Thompson, G.; Hearn, T.; Crosier, M.; Guy, J.; Kirk, D.; Mulligan, L.; Ricco, A.; Piccininni, S.; Marzella, R.; Viggiano, L.; Archidiacono, N. // Human Molecular Genetics;Feb99, Vol. 8 Issue 2, p205 

    Little is known about sequence organization close to human centromeres, despite empirical and theoretical data which suggest that it may be unusual. Here we present maps which physically define large sequence duplications flanking the centromeric satellites of human chromosome 10, together with...

Share

Read the Article

Courtesy of VIRGINIA BEACH PUBLIC LIBRARY AND SYSTEM

Sorry, but this item is not currently available from your library.

Try another library?
Sign out of this library

Other Topics